


					
					![]()  | 
			
got back our sequenced DNA today CCTCTACTTACTATTCCTCCTGTTCTTTATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTAATTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGCACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTAACACCAAAACCTCTA vanessa described hers to be quite clique-ish, mine seems to be more LONER or in pairs. only a few cliques exist actually it seems quite accurate. in the first picture, like im closer to china and portugal and then i got a freaking big shock when i was closely associated with blackfoot. second picture.. closer to australia aborigine, portugal and china third picture. tried the mummy one for fun. this option is quite interesting and fun because... 1) can sequence our own DNAs, don't have to work on jellyfish or whatever 2) lessons are slack. we do no-brainer stuff like counting DNA differences. we get to use computer quite often 3) assessments are as bad as china studies even cs was only an enriched module 4) LT is quite funny that's about it. super tired got back our sequenced DNA today CCTCTACTTACTATTCCTCCTGTTCTTTATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTAATTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGCACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTAACACCAAAACCTCTA vanessa described hers to be quite clique-ish, mine seems to be more LONER or in pairs. only a few cliques exist actually it seems quite accurate. in the first picture, like im closer to china and portugal and then i got a freaking big shock when i was closely associated with blackfoot. second picture.. closer to australia aborigine, portugal and china third picture. tried the mummy one for fun. this option is quite interesting and fun because... 1) can sequence our own DNAs, don't have to work on jellyfish or whatever 2) lessons are slack. we do no-brainer stuff like counting DNA differences. we get to use computer quite often 3) assessments are as bad as china studies even cs was only an enriched module 4) LT is quite funny that's about it. super tired Less  |